Q: Cell type B (transport protein mutant) Time IN [Na+] 0 10 ms 20 ms 150mM 40mM 40mM OUT [Na+] 15mM…
A: Active transport is the transport of molecules across the membrane by use of an energy source. The…
Q: Choose THREE examples that correctly predict the effect of a change on the ecosystem. A decrease in…
A: A food web is a diagram that shows what is eaten by what in an ecological community and how food…
Q: small intestine
A: The small intestine is the site of terminal food digestion, nutrient absorption, and endocrine…
Q: Nondisjunction that results in abnormal number of chromosomes can occur during prophase I.…
A: Nondisjunction can occur when chromosomes fails to separate,during cell division.It causes…
Q: If nondisjunction occurs during meiosis II, how many of the daughter cells will have an incorrect…
A: The trillions of somatic cells that make up the human body have the ability to divide into similar…
Q: Why is erythropoietin a popular drug among athletes? Explain with the physiological mechanism. BIUG…
A: The primary hormone controlling red blood cell (RBC) formation is erythropoietin (EPO). Recombinant…
Q: Draw the chart, demonstrating the mechanisms action of epinephrine on target cells (the typical…
A: Epinephrine It refers to a hormone that plays an important role in the fight-or-flight response of…
Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
A: The initial stage of gene expression, transcription, uses information from a gene to build a…
Q: Drag and drop each item to the correct form of absorption. Movement is down the concentration…
A: Passive adsorption is the one that does not require energy source whereas the active one does…
Q: in which of the following animals would you find nephrida Planarian Cnidarians Bivalves Nematodes…
A: The invertebrate nephridium is an organ that is found in pairs and functions similarly to the…
Q: In tabular from, what are the differences in morphology between monocot and dicot fruits?
A: Introduction Monocotyledonous plants are those angiosperms that have a single cotyledon in their…
Q: Future Uses of Citric Acid in Biotechnology
A: As defined by the National Institutes of Health, biotechnology is a broad field of biology that…
Q: Which one of the following interactions is the strongest known non-covalent interaction? Group of…
A: Non-covalent interactions are the ones that do not include sharing of electrons. These interactions…
Q: Which of the following is not a common nosocomial infection? surgical site infections respiratory…
A: Infections linked to medical care are referred to as nosocomial infections. infections that were…
Q: Lysogeny is a form of viral replication is characterized by a viral prophage is when the virus…
A: Virus It refers to a microscopic pathogen that can replicate only inside a living cell of an…
Q: Explain activation-induced deaminase (AID) induced mutation in the DNA arose by deamination of…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by transcription process…
Q: Leukocytosis would most likely result from fever cancer of the leukocytes inflammation HIV (AIDS)
A: Numerous different cell types can be found in blood, including red blood cells, platelets, and white…
Q: In kangaroos, pouched kangaroos (P) are dc bushy tail of unknown genotype so you dec kangaroos have…
A: Given that, P is the dominant allele for pouched kangaroos whereas p is the recessive allele for…
Q: A Sheepherder rush to you, during one of your surveillance visit to a community, with a concern,…
A: The sheep and goat may get unconscious due to Acidosis The sheep and goat may experience further…
Q: Name the reproductive and non-reproductive parts of bread mould (Rhizopus).
A: Bread mould is a type of fungus that can grow on bread. The mould is made up of tiny spores that…
Q: A student placed populations of duckweed in two identical controlled-environment ponds. Only Lemna…
A: Duckweeds are tiny, floating aquatic plants that are completely edible, nutritious, non-toxic,…
Q: Is there an advantage of dry fruits over fleshy fruits? Give reasons
A: Introduction: Fruit that has practically all of its water content evaporated during drying is…
Q: When species arise as a result of changes in chromosome number that make them incompatible with the…
A: A group of people who regularly interbreed in nature is referred to as a species. A species is the…
Q: In what type of species interaction are both species negatively effected. Briefly describe an…
A: In a natural habitat, the co-inhabiting organisms interact with one another to exert their…
Q: Determine the reason due to which mice should be subjected to X-rays to increase the frequency of…
A: Prior to cell division, DNA replication occurs to get the cell ready for mitosis and meiosis.…
Q: Label all individuals with the correct genotype. If you are not certain of the gentotype, list all…
A: Pedigree analysis: The inheritance of disease from the parents to the offspring can be determined by…
Q: If I have been exposed to an infectious microbe for the second time, which of the following…
A: Immunoglobins or Ig are released by the B-lymphocytes or B-cells and responsible for binding with…
Q: 1. Translocation of sugar in seedling- How come 100% of cotyledons removed from the mung bean plant…
A: Translocation of Sugar in Seedling is higher in 100% cotyelondons removed from Mung Bean Plant is…
Q: DNA is used as a template for making? None of the answer choices are correct. DNA polymerase and…
A: Introduction Deoxyribose nucleic acid is DNA. DNA contains an instructions that needed for…
Q: Assuming you have determined the sequence of a certain enzyme/protein product, how will you identify…
A: Proteins are made up of a string of amino acids the sequence of which is encoded by DNA. Each amino…
Q: The coefficient of relatedness between you and your uncle on your dad's side is O 0.25 O 0.5 O 0.125…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Fishlake national forest in Utah contains a stand of 40,000 aspen trees, all of which came from a…
A: The term "clone" of aspens refers to a stand of aspens because every tree is a genetic duplicate of…
Q: Describe aerobic exercise and anaerobic exercise Explain the advantages and disadvantages of each…
A: The physical activity that enhances or maintains fitness and health is called exercise. Regular…
Q: What is the symbiotic relationship between fungi and plant roots in which fungal hyphae penetrate…
A: Plants are photosynthetic, eukaryotic structure that belongs to kingdom Plantae. It comprises of two…
Q: Liver cells proliferate excessively both in patients with chronic alcoholism and in patients with…
A: The term apoptosis refers to cell death; the term antiapoptosis refers to inhibition of cell death;…
Q: From these tests, we can confirm the bacteria is Streptococcus agalactiae. Now, create a FlowChart…
A: Introduction Gram staining is a process by which we can differentiate between gram positive and gram…
Q: Briefly describe what an ecological disturbance is and provide an example.
A: Ecology is the branch of biology that deals with the relations of organisms to one another and to…
Q: 15. What percent of a typical mammalian genome is classified as an exon? A. 0.7% B. 1.5% C. 3.2% D.…
A: The complete set of genes or the total amount of genetic material present in a cell or an organism…
Q: 1.where we can we find the circle of willis in 10 mm pig embryo?what are the branches associated…
A: 1.The circle of Willis is mainly a vascular network.Basically,the circle of Willis is a part of the…
Q: At the end of meiosis I: the cells are haploid and the homologous pairs are in separate cells.…
A: Meiosis is a two-stage process in which meiosis I can be referred to as the initial division.…
Q: what is Taxol ? What does it Target in cancer cells ? (relate it to cell communication and cell…
A: Introduction : The term "cancer" refers to disorders in which abnormal cells proliferate…
Q: Consider a fish of a schooling species that has damage to its eyes (Fish X) compared to a fish of…
A: Fish schooling is defined as the movement of fish in a group. Fish schooling helps the fish in their…
Q: in which the individual fish swim together in a group. The school is typically made up of fi…
A:
Q: What is cocaine still used for medically?
A: Cocaine is a powerful addictive stimulant drug and it can be obtained from the leaves of two coca…
Q: A particular virus with DNA as its genetic material has the following proportions of nucleotides:…
A: Pentose sugar, phosphate, and a nitrogenous base make up the DNA structure. These nitrogenous bases…
Q: Define hormone. Name the hormone secreted by thyroid gland. Write its function. Why is it advised to…
A: Hormones function as messengers in the body. They are secreted by endocrine glands. Hormones help in…
Q: H.W: Normal value of Intensity of bone, soft tissue, fat, air, metal (stainless steel, titanium…
A: Radiographic density or X-ray density is a measure of degree of film darkening. It is the measure of…
Q: Many people in the developing world die of a water-borne illness simply because they do not have…
A: Cholera It refers to a bacteria disease caused by the bacteria Vibrio cholerae. It is usually spread…
Q: Where will teh proteins synthesized at the ribosome-mRna complex and polypeptide chain?
A: Gene expression comprisers of three steps- replication, transcription and translation. This follows…
Q: In kangaroos, pouched kangaroos (P) are dominant over pouchless kangaroos (p) and bushy tails (B)…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Nucleotides
It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
Nucleic Acids
Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -512. You are working with a picce of DNA of the sequence: 5'-TATTGAGCTCCCCGGAT-3 3'-ATAACTCGAGGGGCCTA-5 You cut the above piece of DNA with a restriction enzyme that recognizes the sequence 5'GAGCTC and cuts on the 3' side of the A within this sequence. Please, draw all products that you get after digestion. Label all 5' and 3' ends.
- 3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…
- 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'-GGCAACGGTCCAGTCCAAGTTACG-3' 6. What are the amino acids coded for by this sequence of nucleotides: ATG GGA ACT CCA 7. What is the complementary messenger-RNA sequence for the DNA sequence shown below? ATC GGA CCG ATT GCC5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two introns in this DNA sequence. Remember introns start with GT and end with AG. (a) How many base pairs are in intron 1 and intron 2.6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3'-TACT GACTG ACGAT C-5'. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each? 6.a. Mutated DNA Template Strand #1: 3'-TACTGTCT GACGATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation: 6.b. Mutated DNA Template Strand #2: 3'-TACG GACT GAC GATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation:
- 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3'-TACT GACTG ACGAT C-5'. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…